Biology High School
Answers
Answer 1
Answer:
a mammal of an order whose members are born incompletely developed and are typically carried and suckled in a pouch on the mother's belly.
Explanation:
Both the questions are answered above.
Related Questions
An increase in stimuli to the brain results in an increase in the responses of an organism. TRUE OR FALSE?
Answers
Answer:
True
Explanation:
As the intensity of stimulus increases abruptly then response increase in continuous as different absolute intensities. In fact the brain is able to respond to the differential change in magnitude of stimuli and not the absolute change in magnitude.
Hence, the given statement is true
Which sentence uses supporting evidence to form the best conclusion about a rattlesnake?
Answers
C is the answer to the question
The sentence that uses the supporting evidence to form the best conclusion about a rattlesnake is as follows:
The rattlesnake's body temperature responded quickly to the environment, so it is an ectotherm.
Thus, the correct option for this question is C.
What are Ectotherms?
Ectotherms may be defined as the type of organisms that can not able to maintain their internal body temperature. They are also known as Poikilotherms. These types of organisms are absent on poles.
Due to a lack of internal maintenance of temperature, they can undergo hibernation and aestivation. Snakes and reptiles are ectothermic in nature. This significantly means that they directly obtain body heat from their environment.
Therefore, the rattlesnake's body temperature responded quickly to the environment, so it is an ectotherm is a sentence that uses the supporting evidence to form the best conclusion about a rattlesnake. Thus, the correct option for this question is C.
To learn more about Ectotherms, refer to the link:
https://brainly.com/question/757440
#SPJ2
In addition to stealing energy
from the host, how can parasites
cause problems for their hosts?
Answers
Answer:
They can cause the deprivation of nutrients, fluids, and metabolites. this may also cause pathological effects in their hosts such as pathogenic effects.
they can be painful and cause illness
Vocabulary:
LLLL
1.
2.
3.
4.
Adaptation
Speciation
Darwin
hom*ologous structures
A. Developed the theory of natural selection
using evidence
B. Similar anatomical structures showing
common ancestry
C. Inherited trait that allows individuals to
survive better
D. New species form due to isolation
Answers
Answer:
A. Charles Darwin.
B. hom*ologous structure
C. Adaptation.
D. Speciation.
Explanation:
Genetics can be defined as the scientific study of hereditary in living organisms such as humans, animals and plants.
Heredity refers to the transfer of traits (specific characteristics) from the parent of a living organism to her offspring through sexual reproduction or asexual production. Some examples of hereditary traits are dimples, tongue rolling, baldness, handedness, freckles, curly hair, color blindness, height, etc.
A. Charles Darwin: he developed the theory of natural selection based on certain evidences. Natural selection can be defined as a biological process in which species of living organisms having certain traits that enable them to adapt to environmental factors such as predators, competition for food, climate change, sex mates, etc., tend to survive and reproduce, as well as passing on their genes to subsequent generations.
B. hom*ologous structure: it involves similar anatomical structures that are having common ancestry or from the same lineage.
C. Adaptation: it is an inherited trait that allows individuals to survive better.
D. Speciation: it is an ecological and biological process through which new species are formed due to isolation.
What are the reactants in
photosynthesis?
Answers
Explanation:
Photosynthesis requires sunlight, carbon dioxide, and water as starting reactants (Figure 5.5). After the process is complete, photosynthesis releases oxygen and produces carbohydrate molecules, most commonly glucose. These sugar molecules contain the energy that living things need to survive.
The role of the excretory system is to rid the body of toxic waste products. Which of these body systems also plays a direct role in removing waste products from the body?
A) endocrine
B) nervous
C) respiratory
D) skeletal
This organ is the primary organ of the integumentary system. It protects, regulates, and prevents water loss. It is your
A) brain.
B) kidneys.
C) skeleton.
D) skin.
Answers
1. The correct answer would be C) respiratory system.
Respiratory system is made up of set of organs which help in taking in oxygen and expelling out carbon dioxide from the body.
In humans, it is composed of nose, pharynx, larynx, trachea, bronchi, pair of lungs, and diaphragm.
Alveoli (in lungs) are the site of gaseous exchange where oxygen is exchange with carbon dioxide.
Carbon dioxide is the toxic waste product of cellular respiration. Circulatory system helps in transporting CO₂ from cells to the alveolar site where it is exchanged with oxygen and excreted out as a part of exhaled air.
2.The correct answer would be D) skin, hope this helps
True or false The sea otter is considered a keystone species that influences the survival of many other species in an ecosystem .
Answers
answer: True
kind of
Which of the following is evidence that cells no longer respond to external factors and may have turned cancerous?
A. New cells replace old or damaged cells.
B. Cell clumps form, crowding existing cells.
C. Dead cells are shed at a more rapid rate.
D. Dormant cells re-enter an active cell cycle.
Answers
Answer:
option C will be the correct answer
Dead cells are shed at a more rapid rate is evidence that cells no longer respond to external factors and may have turned cancerous.
What are the cancer cells?
Cancer cells are defined as cells which divide continually, forming solid tumors or flooding the blood with abnormal cells. Cell division is a normal process used by the body for growth and repair.
Sometimes this orderly process breaks down, and abnormal or damaged cells grow and multiply when they shouldn’t. These cells may form tumors, which are lumps of tissue.
For more information regarding cancer cells, visit:
https://brainly.com/question/373177
#SPJ2
1. Compact, complex animals have internal exchange surfaces that are extensively branched or folded, providing a large _____________.
2. In the _____________, nutrients are absorbed across the many fingerlike projections of the lining of the intestine.
3. In the _____________, oxygen and carbon dioxide are exchanged across the epithelial linings of sacs at the tips of tiny air tubes.
4. In the _____________, wastes are removed from the blood across the epithelial linings of excretory tubes.
5. The _____________ transports materials between the exchange surfaces of other organ systems and body cells.
6. Body cells are bathed in _______________, and exchange between body cells and the blood takes place through this fluid.
Answers
Answer:
1.) Surface area
2.) Digestive system
3.) Respiratory system
4.) Urinary system
5.) Circulatory system
6.) Interstitial fluid
Explanation:
In higher complex animals, such as the vertebrates, the internal exchange surfaces are modified in such a way to facilitate the transfer of materials from cell to cell in the body. As animal size increases, diffusion distances increase and the ratio of surface area to volume drops. Larger organisms have had to evolve specialized systems that are made up of structures that provides a large surface area for internal exchange of materials. Examples of these systems include:
--> DIGESTIVE SYSTEM: The fingerlike projections of the lining of the intestine provide a large surface area for the absorption of nutrients.
--> RESPIRATORY SYSTEM: This ends with a sac called the alveolar sac. The anatomical arrangement of capillaries and alveoli produces a very large surface area that is available for gas exchange.
--> URINARY SYSTEM: wastes are easily removed from the blood across the epithelial linings of excretory tubes.
--> CIRCULATORY SYSTEM: transports materials between the exchange surfaces of other organ systems and body cells. An example is seen in the relationship between the alveoli and the capillaries surrounding it.
For any exchange of materials to occur between cells the fluid known as the INTERSTITIAL FLUID which fills the intercellular spaces allows dissolved materials to be exchanged between body cells and the blood
how do adaptations affect the fitness of an organism
Answers
Adaptations affect the fitness of an organism because the more adapted the organism gets through natural selection their fitness will increase which will increase their overall survival
**15 Points & Branliest** ; Individual 5 in generation III of this pedigree visited a genetic counselor. The counselor made this pedigree that shows the inheritance of cystic fibrosis in this individual’s family.
What information can the genetic counselor share with individual 5 in generation III, based on this pedigree?
- She will never have a child with cystic fibrosis.
- She is a carrier of cystic fibrosis.
- She does not carry the gene for cystic fibrosis.
- She might develop cystic fibrosis later in life.
Answers
Answer:
- She does not carry the gene for cystic fibrosis.
Explanation:
Due to technical problems, you will find the complete explanation in the attached files
Answer:
C
Explanation:
Q: What cellular mechanism causes cancer?
Select one:
a. cells produced with no DNA
b. uncontrolled cell division
c. defective cell membranes
d. cells produced without nuclei
Answers
Answer:
the answer is b
Uncontrolled cell division is a cellular mechanism which causes cancer, hence option B is correct.
What is cancer?
A phrase for conditions where aberrant cells can infect surrounding tissues and divide uncontrollably. The lymphatic and vascular systems of the body are further routes by which cancer cells might spread.
Cancer is a condition wherein a few of the body's cells grow out of control. Cancer comes in many forms, and each one starts when a single cell experiences a genetic change (or mutation) that enables the cell to divide and multiply uncontrollably.
When one or more genes change and produce malignant cells, cancer begins. Tumors are formed by these cancerous cell groupings.
Therefore, cancerous cells may separate from tumors and spread to other parts of your body through your lymphatic system or circulation.
Learn more about cancer, here:
https://brainly.com/question/8590464
#SPJ2
What is the positive aspect of GMO
Answers
The pros of GMO crops are that they may contain more nutrients, are grown with fewer pesticides, and are usually cheaper than their non-GMO counterparts. The cons of GMO foods are that they may cause allergic reactions because of their altered DNA and they may increase antibiotic resistance.
Today, those who directly see the most benefits from GMOs are farmers and agricultural companies. ... GMOs are also used to produce many medicines and vaccines that help treat or prevent diseases. Before GMOs, many common medicines had to be extracted from blood donors, animal parts, or even cadavers.
ツ
Explanation:
There are multiple positive aspects of GMO, but it has many drawbacks as well. Genetically modified foods can become more resistant to disease, pests, and even natural disasters(floods, drought, etc.)
True or False? When populations of the same species are isolated from each other, they are more likely to become two separate species.
Answers
i believe it is true
If haves to be true
In order for water to collect in earths atmosphere and form clouds it must first undergo what process?
A) condensation
B) convection
C) evaporation
D precipitation
Answers
Answer:
The answer is D: Precipitation
Use a Punnett Square of a Bb x Bb cross. B is the factor for brown eyes and bis factor for blue eyes. What color eyes do the parents have:
Answers
Answer:
The parents would have brown eyes.
Explanation:
Given Bb x Bb, this tells you that both parents have brown eyes and are carriers for a reccessive trait (blue eyes). Remember that the uppercase letters are considered dominant and the lower case letters are considered recessive. In order for the blue eye allele to show, you would need to have the genotype: bb.
C. Brown
The parents would have brown eyes.
Given Bb x Bb,
This tells you that both parents have brown eyes and are carriers for a recessive trait (blue eyes). Remember that the uppercase letters are considered dominant and the lower case letters are considered recessive. In order for the blue eye allele to show, you would need to have the genotype: bb.
Therefore, correct option is c.
Learn more:
brainly.com/question/12708051
Which of the following examples support reasons for humans to selectively breed for traits? Select ALL that apply.
1. a bird that can no longer fly
2. watermelons that have less seeds
3. basil plants that require less water
4. corn plants resistant to disease
5. a dog that does not shed its coat
Answers
2, 3, 4, 5, so all numbers but 1
Please answer asap!
In the savanna community there are herds of zebras, stands of acacia trees, clumps of grasses, prides of lions, and insects everywhere. What is one example of a savanna population?
A.
the pride of lions
B.
all of the acacia trees and grasses
C.
all of the predators in the area
D.
the animals, plants, rainfall, temperature, and water supply
Answers
Answer:
probably a or b. I dunno. erm
A. The pride of lions
HELP ASAP WILL GIVE BRAINLIEST RIGHT ANSWER PLS
Answers
Answer:
Explanation: 1. d 2. b 3.e 4. a
What is the goal of PHOTOSYNTHESIS?
Answers
Answer:
the goal of photosynthesis is to make food for the plant
Explanation:
because a plant can't move a plant needs moving to hunt for food but unfortunately a plant can't move so the goal of photosynthesis is to make food for the plant hope this help:)
cichlids fish evolution, as seen in lake victoria in africa, is an example of ______ equilibrium.
Answers
Answer:
Evolution
Explanation:
The cichlids fish evolution, as seen in lake victoria in africa, is an example of Evolution equilibrium.
What is evolution?
The gradual change of an organism over a period of time is called evolution.
Evolution is the population phenomenon. The sudden change in an individual is called a mutation.
These are the thing that leads to the evolution:-
Natural selection ReproductionCrossing over.
Thus, is an example of Evolution equilibrium.
To learn more about Evolution Click here:
https://brainly.com/question/13492988
#SPJ2
if environmental conditions change over time it’s most likely a population of organisms in the environment will survive if...
Answers
the answer is “there is genetic variation within the population”
why do humans have good memory
Answers
Humans have good memory because of their brain, one part of the human brain has a function just for memory!
HELP PAST DUE AND NO WEBISTES/ FAKE LINKS
your own words: how does the temperture affect the denisty of the water? DO NOT COPY AND PASTE FROM THE INTERNET OR YOUR REPORTED!
Answers
When a certain amount of water is heated up, it expands, increasing in volume changing the density. This goes for when it’s heated or cooled; the density then changes.
when scientists talk about something's nature, they are talking about its
nurture
acquired traits
inherited traits
combined inherited and acquired traits
Answers
Inherited trait : Trait received by offspring from parent. Both physical or behavioral characteristics can be inherited. Behavioral trait is also called instinct. ... Acquired trait: Behaviors or that are learned or acquired through interaction with environment and life experiences.
Please help :). Will give brainiest!! I only need the first part don’t answer #2 or #3
Answers
It should be
AGATACCATGGTTACCCGGTTCCA
How did the polar bears get their white fur?A.Bears have various alleles for fur color ranging from dark to light. Those bears with the lighter fur had a better chance of survival in the biome, so they lived and reproduced passing on their light colored gene to their offspring. As generations passed, white fur became more common.B.As a polar bear grows up, its fur gradually gets lighter, so by the time they are a teenager, they have fully white fur and are then best suited to survive in their environment.C.Polar Bears migrated from the Pacific Northwest up to the Tundra and Arctic because they knew that they would have a better chance of surviving in this cold region.
Answers
Answer:
I believe it’s c report me if I’m wrong on this
Explanation:
En un bosque oscuro, ¿qué variación de la polilla salpicada se reproduciría en
mayor número? En este escenario, la variación
de la polilla moteada
se reproduciría en mayor número debido a.
Answers
Answer:
Condiciones ambientales adecuadas.
Explicación:
La variación de la polilla moteada se reproduciría en mayor número debido a las condiciones ambientales adecuadas. El color oscuro del bosque ayuda a la polilla moteada a esconderse de sus depredadores que se alimentan de ellos y provoca la disminución de la población de polillas. Es un proceso de selección natural en el que la polilla de color oscuro sobrevive y aumenta la población debido al color oscuro del bosque, mientras que la población de polilla de color claro disminuye debido a la alta depredación.
No links please im already failing
Answers
Answer:
Think its the last one
The answer is C because you cannot change it back into what it was before unlike the other ones it’s the same as before.
The paper is still paper, the wall is still a wall just painted, and the ice melted is still water like it was before it was just frozen.
Hope this helps
What is the "body" of a plant called?
Answers
Answer:
it's called a tissue right?
